-
PurposePlasmid for expression of gene of interest in Lactobacillus plantarum and L. sakei
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122028 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonespp-based expression vector (pSIP401)
- Backbone size w/o insert (bp) 5400
- Total vector size (bp) 7435
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Erythromycin, 200 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegusA
-
Insert Size (bp)1809
- Promoter sppA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (unknown if destroyed)
- 3′ cloning site Multi cloning site (eg EcoRI) (unknown if destroyed)
- 5′ sequencing primer GGCTTTTATAATATGAGATAATGCCGAC
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSIP403 was a gift from Lars Axelsson & Geir Mathiesen (Addgene plasmid # 122028 ; http://n2t.net/addgene:122028 ; RRID:Addgene_122028) -
For your References section:
High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors. Sorvig E, Mathiesen G, Naterstad K, Eijsink VG, Axelsson L. Microbiology. 2005 Jul;151(Pt 7):2439-49. doi: 10.1099/mic.0.28084-0. 10.1099/mic.0.28084-0 PubMed 16000734