Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pSIP403
(Plasmid #122028)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 122028 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    spp-based expression vector (pSIP401)
  • Backbone size w/o insert (bp) 5400
  • Total vector size (bp) 7435
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Erythromycin, 200 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    gusA
  • Insert Size (bp)
    1809
  • Promoter sppA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (unknown if destroyed)
  • 3′ cloning site Multi cloning site (eg EcoRI) (unknown if destroyed)
  • 5′ sequencing primer GGCTTTTATAATATGAGATAATGCCGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSIP403 was a gift from Lars Axelsson & Geir Mathiesen (Addgene plasmid # 122028 ; http://n2t.net/addgene:122028 ; RRID:Addgene_122028)
  • For your References section:

    High-level, inducible gene expression in Lactobacillus sakei and Lactobacillus plantarum using versatile expression vectors. Sorvig E, Mathiesen G, Naterstad K, Eijsink VG, Axelsson L. Microbiology. 2005 Jul;151(Pt 7):2439-49. doi: 10.1099/mic.0.28084-0. 10.1099/mic.0.28084-0 PubMed 16000734