pRRLSIN.cPPT.PGK.MyoD.WPRE
(Plasmid
#122053)
-
PurposeLentiviral expression of MyoD
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 122053 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepRRLSIN.cPPT.PGK.WPRE
- Backbone size w/o insert (bp) 6667
- Total vector size (bp) 8475
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameMyoD
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)957
-
GenBank IDNM_010866.2
-
Entrez GeneMyod1 (a.k.a. MYF3, MyoD, Myod-1, bHLHc1)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer AGTCGGCTCCCTCGTTGACC
- 3′ sequencing primer CAGCGTATCCACATAGCGTAAA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pRRLSIN.cPPT.PGK.MyoD.WPRE was a gift from Stephen Tapscott (Addgene plasmid # 122053 ; http://n2t.net/addgene:122053 ; RRID:Addgene_122053) -
For your References section:
Conversion of MyoD to a neurogenic factor: binding site specificity determines lineage. Fong AP, Yao Z, Zhong JW, Johnson NM, Farr GH 3rd, Maves L, Tapscott SJ. Cell Rep. 2015 Mar 31;10(12):1937-46. doi: 10.1016/j.celrep.2015.02.055. Epub 2015 Mar 19. 10.1016/j.celrep.2015.02.055 PubMed 25801030