Skip to main content

pLenti spCas9 T2A TagRFP-T P2A puro
(Plasmid #122200)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122200 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    spCas9
  • Alt name
    human-codon-optimized spCas9
  • Insert Size (bp)
    4101

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site EcoRI (unknown if destroyed)
  • 5′ sequencing primer GACAAGAAGTACAGCATCGGCCT
  • 3′ sequencing primer GTCGCCTCCCAGCTGAGACA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TagRFP-T
  • Insert Size (bp)
    732
  • GenBank ID
    EU582019.1
  • Tag / Fusion Protein
    • T2A (C terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site XbaI (unknown if destroyed)
  • 5′ sequencing primer cagaggaagtctgctaacatgcg
  • 3′ sequencing primer caggattctcttcgacatctccg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Feng Zhang

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti spCas9 T2A TagRFP-T P2A puro was a gift from Raphael Gaudin (Addgene plasmid # 122200 ; http://n2t.net/addgene:122200 ; RRID:Addgene_122200)