Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We have implemented updates to our Transparency and Privacy Policy.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #122301)


Item Catalog # Description Quantity Price (USD)
Plasmid 122301 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 5450
  • Total vector size (bp) 6950
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • GenBank ID
  • Entrez Gene
    RSL1D1 (a.k.a. CSIG, L12, PBK1, UTP30)
  • Promoter CMV
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRV (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer T7: TAATACGACTCACTATAGGG
  • 3′ sequencing primer SP6: ATTTAGGTGACACTATAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-3xFLAG-RSL1D1(WT) was a gift from Gerardo Ferbeyre (Addgene plasmid # 122301 ; ; RRID:Addgene_122301)
  • For your References section:

    Senescence-associated ribosome biogenesis defects contributes to cell cycle arrest through the Rb pathway. Lessard F, Igelmann S, Trahan C, Huot G, Saint-Germain E, Mignacca L, Del Toro N, Lopes-Paciencia S, Le Calve B, Montero M, Deschenes-Simard X, Bury M, Moiseeva O, Rowell MC, Zorca CE, Zenklusen D, Brakier-Gingras L, Bourdeau V, Oeffinger M, Ferbeyre G. Nat Cell Biol. 2018 Jul;20(7):789-799. doi: 10.1038/s41556-018-0127-y. Epub 2018 Jun 25. 10.1038/s41556-018-0127-y PubMed 29941930