pLenti-FoxJ1 promoter-IRES-EGFP-Flag-hChibby1
(Plasmid
#122964)
-
PurposeExpresses Flag-tagged Chibby1 in multiciliated cells under FoxJ1 promoter. It can be used as a cloning vector for gene of interest at SfiI sites.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 122964 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti-FoxJ1 promoter-IRES-EGFP
-
Modifications to backboneThe original EF1α promoter in pLenti-EF1alpha-IRES-EGFP was replaced with a 1-kb human FoxJ1 promoter.
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman Chibby1
-
SpeciesH. sapiens (human)
-
Entrez GeneCBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
- Promoter human FoxJ1
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfiI (not destroyed)
- 3′ cloning site SfiI (not destroyed)
- 5′ sequencing primer CACCACATACTTATTCGGAG
- 3′ sequencing primer AAGCGGCTTCGGCCAGTAAC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The FoxJ1 promoter DNA was kindly provided by Dr. Steven Brody at Washington University.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-FoxJ1 promoter-IRES-EGFP-Flag-hChibby1 was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122964 ; http://n2t.net/addgene:122964 ; RRID:Addgene_122964)