Skip to main content

pLenti-FoxJ1 promoter-IRES-EGFP-Flag-hChibby1
(Plasmid #122964)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 122964 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti-FoxJ1 promoter-IRES-EGFP
  • Modifications to backbone
    The original EF1α promoter in pLenti-EF1alpha-IRES-EGFP was replaced with a 1-kb human FoxJ1 promoter.
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Chibby1
  • Species
    H. sapiens (human)
  • Entrez Gene
    CBY1 (a.k.a. C22orf2, CBY, Chibby1, HS508I15A, PGEA1, PIGEA-14, PIGEA14, arb1)
  • Promoter human FoxJ1
  • Tag / Fusion Protein
    • Flag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfiI (not destroyed)
  • 3′ cloning site SfiI (not destroyed)
  • 5′ sequencing primer CACCACATACTTATTCGGAG
  • 3′ sequencing primer AAGCGGCTTCGGCCAGTAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The FoxJ1 promoter DNA was kindly provided by Dr. Steven Brody at Washington University.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-FoxJ1 promoter-IRES-EGFP-Flag-hChibby1 was a gift from FENG-QIAN Li & Ken-Ichi Takemaru (Addgene plasmid # 122964 ; http://n2t.net/addgene:122964 ; RRID:Addgene_122964)