-
PurposeChemogenetic activator expression plasmid
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123066 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG IRES eGFP WPRE
- Backbone size w/o insert (bp) 6600
- Total vector size (bp) 8665
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePSAM4 5HT3 LC IRES GFP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)2763
-
MutationL131G Q139L Y217F
-
Entrez GeneHtr3a (a.k.a. 5-HT3, 5-HT3A, 5-HT3R)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer cgtcgccgtccagctcgaccag
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that there are ambiguous bases in the CAG promoter due to difficulties sequencing through GC-rich regions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG PSAM4 5HT3 LC IRES GFP was a gift from Scott Sternson (Addgene plasmid # 123066 ; http://n2t.net/addgene:123066 ; RRID:Addgene_123066) -
For your References section:
Ultrapotent chemogenetics for research and potential clinical applications. Magnus CJ, Lee PH, Bonaventura J, Zemla R, Gomez JL, Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM. Science. 2019 Mar 14. pii: science.aav5282. doi: 10.1126/science.aav5282. 10.1126/science.aav5282 PubMed 30872534