Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #123066)


Item Catalog # Description Quantity Price (USD)
Plasmid 123066 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 6600
  • Total vector size (bp) 8665
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
  • Mutation
    L131G Q139L Y217F
  • Entrez Gene
    Htr3a (a.k.a. 5-HT3, 5-HT3A, 5-HT3R)
  • Promoter CAG

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
  • 3′ sequencing primer cgtcgccgtccagctcgaccag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG PSAM4 5HT3 LC IRES GFP was a gift from Scott Sternson (Addgene plasmid # 123066 ; ; RRID:Addgene_123066)
  • For your References section:

    Ultrapotent chemogenetics for research and potential clinical applications. Magnus CJ, Lee PH, Bonaventura J, Zemla R, Gomez JL, Ramirez MH, Hu X, Galvan A, Basu J, Michaelides M, Sternson SM. Science. 2019 Mar 14. pii: science.aav5282. doi: 10.1126/science.aav5282. 10.1126/science.aav5282 PubMed 30872534