pcDNA6-N-3XFLAG-Gp78
(Plasmid
#123590)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 123590 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA6
- Backbone size w/o insert (bp) 5079
- Total vector size (bp) 6999
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameautocrine motility factor receptor
-
Alt namegp78
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1920
-
GenBank IDNM_011787.2
-
Entrez GeneAmfr (a.k.a. gp78)
-
Tag
/ Fusion Protein
- FLAG (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA6-N-3XFLAG-Gp78 was a gift from Bruce Beutler (Addgene plasmid # 123590 ; http://n2t.net/addgene:123590 ; RRID:Addgene_123590) -
For your References section:
LMBR1L regulates lymphopoiesis through Wnt/beta-catenin signaling. Choi JH, Zhong X, McAlpine W, Liao TC, Zhang D, Fang B, Russell J, Ludwig S, Nair-Gill E, Zhang Z, Wang KW, Misawa T, Zhan X, Choi M, Wang T, Li X, Tang M, Sun Q, Yu L, Murray AR, Moresco EMY, Beutler B. Science. 2019 May 10;364(6440). pii: 364/6440/eaau0812. doi: 10.1126/science.aau0812. 10.1126/science.aau0812 PubMed 31073040