Skip to main content

BE3(E63Q)-P2A-EGFP (pRZ189)
(Plasmid #123613)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 123613 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    CAG
  • Backbone manufacturer
    pSQT817 (Addgene #53373)
  • Backbone size w/o insert (bp) 4843
  • Total vector size (bp) 10768
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BE3(E63Q)-P2A-EGFP
  • Alt name
    rAPOBEC1(E63Q)-XTEN-hSpCas9n(D10A)-UGI-NLS(SV40)-P2A-EGFP
  • Species
    R. norvegicus (rat), Synthetic; Streptococcus pyogenes, Bacillus subtilis bacteriophage PBS1
  • Insert Size (bp)
    5925
  • Mutation
    E63Q in rAPOBEC1, D10A in SpCas9
  • GenBank ID
  • Promoter CAG

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CTCTGCTAACCATGTTCATGCC
  • 3′ sequencing primer CAGAGGGAAAAAGATCTCAGTGG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Liu Lab (BE3, Addgene #73021) and Benjamin Kleinstiver (BPK4335)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BE3(E63Q)-P2A-EGFP (pRZ189) was a gift from Keith Joung (Addgene plasmid # 123613 ; http://n2t.net/addgene:123613 ; RRID:Addgene_123613)
  • For your References section:

    Transcriptome-wide off-target RNA editing induced by CRISPR-guided DNA base editors. Grunewald J, Zhou R, Garcia SP, Iyer S, Lareau CA, Aryee MJ, Joung JK. Nature. 2019 Apr 17. pii: 10.1038/s41586-019-1161-z. doi: 10.1038/s41586-019-1161-z. 10.1038/s41586-019-1161-z PubMed 30995674