pT2-shATRX
(Plasmid
#124258)
-
PurposeExpresses shRNA targeting ATRX. Construct has inverted repeats to be used in Sleeping beauty system.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124258 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepT2
- Backbone size w/o insert (bp) 6491
- Total vector size (bp) 6601
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameshATRX
-
gRNA/shRNA sequenceTCGAGAAGGTATATTGCTGTTGACAGTGAGCGCCCGCTTGGATGGTTCTACTAATAGTGAAGCCACAGATGTATTAGTAGAACCATCCAAGCGGTTGCCTACTGCCTCGG
-
SpeciesM. musculus (mouse)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byJohn Ohlfest
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pT2-shATRX was a gift from Maria Castro (Addgene plasmid # 124258 ; http://n2t.net/addgene:124258 ; RRID:Addgene_124258) -
For your References section:
IDH1-R132H acts as a tumor suppressor in glioma via epigenetic up-regulation of the DNA damage response. Nunez FJ, Mendez FM, Kadiyala P, Alghamri MS, Savelieff MG, Garcia-Fabiani MB, Haase S, Koschmann C, Calinescu AA, Kamran N, Saxena M, Patel R, Carney S, Guo MZ, Edwards M, Ljungman M, Qin T, Sartor MA, Tagett R, Venneti S, Brosnan-Cashman J, Meeker A, Gorbunova V, Zhao L, Kremer DM, Zhang L, Lyssiotis CA, Jones L, Herting CJ, Ross JL, Hambardzumyan D, Hervey-Jumper S, Figueroa ME, Lowenstein PR, Castro MG. Sci Transl Med. 2019 Feb 13;11(479). pii: 11/479/eaaq1427. doi: 10.1126/scitranslmed.aaq1427. 10.1126/scitranslmed.aaq1427 PubMed 30760578