Skip to main content
Addgene

pLenti-HRE-dUnaG
(Plasmid #124372)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124372 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti X1 Puro DEST (Addgene #17297)
  • Backbone manufacturer
    Eric Campeau & Paul Kaufman
  • Backbone size w/o insert (bp) 9031
  • Total vector size (bp) 8646
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HRE-dUnaG
  • Species
    Anguilla japonica
  • Insert Size (bp)
    1300
  • Promoter HRE (HIF responsive element 5x + CMV minimal promoter)
  • Tag / Fusion Protein
    • PEST-degron and Myc tag (C terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer Primer 1 CACCGTACCGAGCTTTTCTCGAGC
  • 3′ sequencing primer Primer 2 CAGCTGGTTCTTTCCGCCTC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    the HRE-UnaG insert was obtained from a plasmid that we received with an MTA from the Max-Planck Institute Münster, Germany

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-HRE-dUnaG was a gift from Roland Friedel (Addgene plasmid # 124372 ; http://n2t.net/addgene:124372 ; RRID:Addgene_124372)
  • For your References section:

    Hypoxic niches attract and sequester tumor-associated macrophages and cytotoxic T cells and reprogram them for immunosuppression. Sattiraju A, Kang S, Giotti B, Chen Z, Marallano VJ, Brusco C, Ramakrishnan A, Shen L, Tsankov AM, Hambardzumyan D, Friedel RH, Zou H. Immunity. 2023 Jul 7:S1074-7613(23)00274-1. doi: 10.1016/j.immuni.2023.06.017. 10.1016/j.immuni.2023.06.017 PubMed 37451265