pCggRO-reporter
(Plasmid
#124582)
-
PurposeReporter plasmid with Constitutively expressed mCherry and CggR-regulated YFP (eCitrine)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124582 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonep416
-
Vector typeYeast Expression
-
Selectable markersNeomycin (select with G418), URA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCggR promoter element
-
SpeciesSynthetic
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATGTCTAAAGGTGAAGAATTATTCACTGGTGTTGTC
- 3′ sequencing primer TCGACACTGGATGGCGGCGTTAGTATCGAATCGACAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/682302v1 for BioRxiv preprint
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCggRO-reporter was a gift from Matthias Heinemann (Addgene plasmid # 124582 ; http://n2t.net/addgene:124582 ; RRID:Addgene_124582) -
For your References section:
Measuring glycolytic flux in single yeast cells with an orthogonal synthetic biosensor. Monteiro F, Hubmann G, Takhaveev V, Vedelaar SR, Norder J, Hekelaar J, Saldida J, Litsios A, Wijma HJ, Schmidt A, Heinemann M. Mol Syst Biol. 2019 Dec;15(12):e9071. doi: 10.15252/msb.20199071. 10.15252/msb.20199071 PubMed 31885198