Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #124769)


Item Catalog # Description Quantity Price (USD)
Plasmid 124769 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 3729
  • Total vector size (bp) 9131
  • Vector type

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Insert Size (bp)

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 3′ sequencing primer TCAGTCACCTCCTAGCTGACTCAA
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    PpflB sgRNA BsaI
  • Species
    Synthetic; synthetic fragment
  • Insert Size (bp)

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTCTTTATGAAACACGCATTGA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFD116 was a gift from David Bikard (Addgene plasmid # 124769 ; ; RRID:Addgene_124769)
  • For your References section:

    Gene silencing with CRISPRi in bacteria and optimization of dCas9 expression levels. Depardieu F, Bikard D. Methods. 2019 Aug 1. pii: S1046-2023(18)30497-3. doi: 10.1016/j.ymeth.2019.07.024. 10.1016/j.ymeth.2019.07.024 PubMed 31377338