nSYB-GAL80-DD
(Plasmid
#124778)
-
PurposeExpresses GAL80 fused with destabilizing domain (DD) downstream of a n-Synaptobrevin promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124778 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepattB-nsyb
- Total vector size (bp) 11359
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTMP-inducible destabilized GAL80 (GAL80-DD)
-
Alt nameGAL80-ecDHFR
-
SpeciesD. melanogaster (fly)
- Promoter nSynaptobrevin
-
Tag
/ Fusion Protein
- DD (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site AatII (unknown if destroyed)
- 5′ sequencing primer SYBFOR5: TGGAAGACAGTGAAAGAGGC
- 3′ sequencing primer hsp70REV-SEQ:GCAAACTCACTCCCTGACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The nSYB promoter contains several polymorphisms compared to the reference sequence that do not affect the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
nSYB-GAL80-DD was a gift from Jing-W Wang (Addgene plasmid # 124778 ; http://n2t.net/addgene:124778 ; RRID:Addgene_124778) -
For your References section:
A versatile genetic tool for post-translational control of gene expression in Drosophila melanogaster. Sethi S, Wang JW. Elife. 2017 Nov 15;6. pii: e30327. doi: 10.7554/eLife.30327. 10.7554/eLife.30327 PubMed 29140243