-
PurposeExpresses multimeric human VWF with C-terminal c-Myc tag
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124794 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3.1
- Total vector size (bp) 13893
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVWF
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8480
-
Entrez GeneVWF (a.k.a. F8VWF, VWD)
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer taggcgtgtacggtgggaggtct (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
I471V mutation in VWF has no impact on function
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-WT-VWF was a gift from Sriram Neelamegham (Addgene plasmid # 124794 ; http://n2t.net/addgene:124794 ; RRID:Addgene_124794) -
For your References section:
von Willebrand factor self-association is regulated by the shear-dependent unfolding of the A2 domain. Zhang C, Kelkar A, Neelamegham S. Blood Adv. 2019 Apr 9;3(7):957-968. doi: 10.1182/bloodadvances.2018030122. 10.1182/bloodadvances.2018030122 PubMed 30936056