-
PurposeExpresses AXL in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 124796 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti CMV Neo DEST (705-1)
-
Backbone manufacturerAddgene 17392 (Eric Campeau & Paul Kaufman)
- Backbone size w/o insert (bp) 9805
- Total vector size (bp) 10838
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsOther strains are also appropriate.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAXL
-
Alt nameAXL tyrosine receptor kinase
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2683
-
GenBank IDNM_021913
-
Entrez GeneAXL (a.k.a. ARK, AXL3, JTK11, Tyro7, UFO)
- Promoter CMV
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV-forward: CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLentiCMVNeoDEST(705-1)-hAXL was a gift from Kenneth Pienta (Addgene plasmid # 124796 ; http://n2t.net/addgene:124796 ; RRID:Addgene_124796) -
For your References section:
AXL Is a Putative Tumor Suppressor and Dormancy Regulator in Prostate Cancer. Axelrod HD, Valkenburg KC, Amend SR, Hicks JL, Parsana P, Torga G, DeMarzo AM, Pienta KJ. Mol Cancer Res. 2019 Feb;17(2):356-369. doi: 10.1158/1541-7786.MCR-18-0718. Epub 2018 Oct 5. 10.1158/1541-7786.MCR-18-0718 PubMed 30291220