Skip to main content
Addgene

pCAD16_CAD_12-490_pvp008
(Plasmid #124842)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 124842 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCOLADuet-1
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 3519
  • Total vector size (bp) 4956
  • Modifications to backbone
    N-terminal StrepTag and TEV site
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    cis-aconitate decarboxylase
  • Alt name
    CAD
  • Species
    Synthetic; Aspergillus terreus
  • Insert Size (bp)
    1437
  • Mutation
    deleted amino acids 1-11, synthetic codon optimized gene
  • GenBank ID
    BAG49047 AB326105
  • Promoter T7
  • Tags / Fusion Proteins
    • StrepTag (N terminal on backbone)
    • TEV site (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TACGACTCACTATAGGGGAATTGTG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGGTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAD16_CAD_12-490_pvp008 was a gift from Konrad Buessow (Addgene plasmid # 124842 ; http://n2t.net/addgene:124842 ; RRID:Addgene_124842)
  • For your References section:

    Crystal structure of cis-aconitate decarboxylase reveals the impact of naturally occurring human mutations on itaconate synthesis. Chen F, Lukat P, Iqbal AA, Saile K, Kaever V, van den Heuvel J, Blankenfeldt W, Bussow K, Pessler F. Proc Natl Acad Sci U S A. 2019 Sep 23. pii: 1908770116. doi: 10.1073/pnas.1908770116. 10.1073/pnas.1908770116 PubMed 31548418