Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #124843)


Item Catalog # Description Quantity Price (USD)
Plasmid 124843 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
  • Backbone size w/o insert (bp) 3519
  • Total vector size (bp) 4893
  • Modifications to backbone
    N-terminal StrepTag and TEV site
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
    cis-aconitate decarboxylase
  • Alt name
  • Alt name
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Mutation
    deleted amino acids 1-3 and 462-end.
  • GenBank ID
  • Entrez Gene
    ACOD1 (a.k.a. CAD, IRG1)
  • Promoter T7
  • Tag / Fusion Protein
    • StrepTag and TEV site (N terminal on backbone)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TACGACTCACTATAGGGGAATTGTG
  • 3′ sequencing primer TGCTAGTTATTGCTCAGCGGTGGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Method for purification of the human enzyme cis-aconitate decarboxylase (ACOD1) from this plasmid in recombinant E. coli cells:

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAD29_hIRG1_4-461_pvp008 was a gift from Konrad Buessow (Addgene plasmid # 124843 ; ; RRID:Addgene_124843)
  • For your References section:

    Crystal structure of cis-aconitate decarboxylase reveals the impact of naturally occurring human mutations on itaconate synthesis. Chen F, Lukat P, Iqbal AA, Saile K, Kaever V, van den Heuvel J, Blankenfeldt W, Bussow K, Pessler F. Proc Natl Acad Sci U S A. 2019 Sep 23. pii: 1908770116. doi: 10.1073/pnas.1908770116. 10.1073/pnas.1908770116 PubMed 31548418