-
Purposelabelling of neuronal nuclear envelope with EGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 124882 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CaMKII-EGFP
-
Backbone manufacturerAddgene#50469
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP
- Promoter CaMKII
-
Tag
/ Fusion Protein
- KASH (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer AAGGACGACGGCAACTACAA
- 3′ sequencing primer CAGAGGTTGATTATCGATAA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
bioRxiv pre-print 10.1101/579250
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CaMKII-EGFPKASH was a gift from Vassilis Pachnis (Addgene plasmid # 124882 ; http://n2t.net/addgene:124882 ; RRID:Addgene_124882) -
For your References section:
Neuronal programming by microbiota regulates intestinal physiology. Obata Y, Castano A, Boeing S, Bon-Frauches AC, Fung C, Fallesen T, de Aguero MG, Yilmaz B, Lopes R, Huseynova A, Horswell S, Maradana MR, Boesmans W, Vanden Berghe P, Murray AJ, Stockinger B, Macpherson AJ, Pachnis V. Nature. 2020 Feb;578(7794):284-289. doi: 10.1038/s41586-020-1975-8. Epub 2020 Feb 5. 10.1038/s41586-020-1975-8 PubMed 32025031