pCI-syn-fRCaMP1
(Plasmid
#125245)
-
PurposeExpresses red fluorescent calcium sensor in hippocampal slices
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125245 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCI
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 3703
- Total vector size (bp) 5088
-
Modifications to backboneCMV promoter replaced by synapsin promoter
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namefRCaMP1
-
Alt namejRCaMP1a RS-1
-
SpeciesR. norvegicus (rat), G. gallus (chicken); E. quadricolor (Sea anemone)
-
Insert Size (bp)1385
-
MutationW44Y
- Promoter synapsin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer T7
- 3′ sequencing primer TCCACCATGGTGCAGAACGAGCTTGCTCTTAAG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byAddgene #61562
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
fRCaMP1 is the W44Y variant of the jRCaMP1a gene cloned from the pGP-CMV vector (#61562) published by Dana et al. 2016.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCI-syn-fRCaMP1 was a gift from Katalin Torok (Addgene plasmid # 125245 ; http://n2t.net/addgene:125245 ; RRID:Addgene_125245) -
For your References section:
The kinetic mechanisms of fast-decay red-fluorescent genetically encoded calcium indicators. Kerruth S, Coates C, Durst CD, Oertner TG, Torok K. J Biol Chem. 2019 Mar 15;294(11):3934-3946. doi: 10.1074/jbc.RA118.004543. Epub 2019 Jan 16. 10.1074/jbc.RA118.004543 PubMed 30651353