pAAV-Syn-Chronos-tdTomato
(Plasmid #62726)

• Purpose: AAV-mediated expression of Chronos-tdTomato under the Syn promoter. Using bGHpA signal. tdTomato has codons varied between the first and second tandem repeats to reduce recombination.
• Depositing Lab: Edward Boyden
• Publication: Klapoetke et al Nat Methods. 2014 Mar;11(3):338-46. doi: 10.1038/nmeth.2836. Epub 2014 Feb 9.

Ordering

Item	Catalog #	Description	Quantity	Price (USD)
Plasmid	62726	Standard format: Plasmid sent in bacteria as agar stab	1	$75	Add to Cart
AAV8	62726-AAV8	Limited Stock Available, 2 units left Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. More Information	1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30	$380	Add to Cart

This material is available to academics and nonprofits only.

Backbone

• Vector backbone: AAV-Syn
  (Search Vector Database)
• Backbone manufacturer: original from Stratagene
• Backbone size w/o insert (bp): 4368
• Total vector size (bp): 6789
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: DH5alpha at 37°C or Stbl3 at 30°C. Carbenicillin is preferred over ampicillin. In DH5alpha this plasmid may act more like a high copy plasmid, although in Stbl3 it may act more like a low copy plasmid.
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Chronos-tdTomato
• Alt name: Stigeoclonium helveticum channelrhodopsin-tdTomato
• Alt name: ChR90-tdTomato
• Species: Stigeoclonium helveticum
• Insert Size (bp): 2421
• GenBank ID: KF992040
• Promoter: human synapsin promoter
• Tag / Fusion Protein:
  • tdTomato (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: gcacgggcgcgaccatctgc
• 3′ sequencing primer: TAGCGTAAAAGGAGCAACATAG

Resource Information

• Terms and Licenses:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Articles Citing this Plasmid:
  • 4 References

Depositor Comments

The plasmid is fully sequenced in the coding sequence regions (opsin-fluorophore and important flanking regions). Multiple digestions were done to verify the vector structure. The construct and the virus were both tested in vitro.

Information for AAV8 (Catalog # 62726-AAV8)

Purpose

Ready-to-use AAV8 particles produced from pAAV-Syn-Chronos-tdTomato (#62726). In addition to the viral particles, you will also receive purified pAAV-Syn-Chronos-tdTomato plasmid DNA.

Syn-driven Chronos-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $350 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV8 cap gene
• Buffer: PBS + 0.001% Pluronic F-68
• Serotype: AAV8
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: tdTomato

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Resource Information

• Terms and Licenses:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.