-
PurposeFor expression of the genetically encoded dopamine sensor dLight1.3b
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 125560 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
| AAV1 | 125560-AAV1 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $437 | ||
| AAV5 | 125560-AAV5 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $437 | ||
| AAV9 | 125560-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $437 | ||
Don’t see the serotype you want?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepAAV-CAG
- Backbone size w/o insert (bp) 5020
- Total vector size (bp) 7063
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedLight1.3b
-
SpeciesSynthetic
-
Insert Size (bp)2043
-
GenBank IDMH244552.1
- Promoter CAG
-
Tag
/ Fusion Protein
- Flag tag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GGTTCGGCTTCTGGCGTGTGACC
- 3′ sequencing primer CCAGGATTTATACAAGGAGG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Addgene NGS identified chicken beta-actin promoter, but not the CMV enhancer and chimeric intron often associated with CAG promoters.
dLight1.3b is also described in Nature. 2019 Jun;570(7759):65-70
Information for AAV1 (Catalog # 125560-AAV1) ( Back to top)
Purpose
Ready-to-use AAV1 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA.
CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Poloxamer 188
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV5 (Catalog # 125560-AAV5) ( Back to top)
Purpose
Ready-to-use AAV5 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA.
CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV5 cap gene
- Buffer PBS + 0.001% Poloxamer 188 + 200 mM NaCl
- Serotype AAV5
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV9 (Catalog # 125560-AAV9) ( Back to top)
Purpose
Ready-to-use AAV9 particles produced from pAAV-CAG-dLight1.3b (#125560). In addition to the viral particles, you will also receive purified pAAV-CAG-dLight1.3b plasmid DNA.
CAG-driven expression of dLight1.3b dopamine sensor. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $405 USD for preparation of 100 µL virus + $32 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Poloxamer 188
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-CAG-dLight1.3b was a gift from Lin Tian (Addgene plasmid # 125560 ; http://n2t.net/addgene:125560 ; RRID:Addgene_125560) For viral preps, please replace (Addgene plasmid # 125560) in the above sentence with: (Addgene viral prep # 125560-AAV1), (Addgene viral prep # 125560-AAV5), or (Addgene viral prep # 125560-AAV9) -
For your References section:
Ultrafast neuronal imaging of dopamine dynamics with designed genetically encoded sensors. Patriarchi T, Cho JR, Merten K, Howe MW, Marley A, Xiong WH, Folk RW, Broussard GJ, Liang R, Jang MJ, Zhong H, Dombeck D, von Zastrow M, Nimmerjahn A, Gradinaru V, Williams JT, Tian L. Science. 2018 Jun 29;360(6396). pii: science.aat4422. doi: 10.1126/science.aat4422. Epub 2018 May 31. 10.1126/science.aat4422 PubMed 29853555