Skip to main content

pLKO.1-puro-shRFP
(Plasmid #125778)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 125778 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLKO.1-puro
  • Backbone size w/o insert (bp) 8901
  • Vector type
    CRISPR
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    shRFP
  • gRNA/shRNA sequence
    CTCAGTTCCAGTACGGCTCCA
  • Insert Size (bp)
    25

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (destroyed during cloning)
  • 3′ cloning site EcoRI (destroyed during cloning)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/502070v1 for BioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLKO.1-puro-shRFP was a gift from Francisca Vazquez (Addgene plasmid # 125778 ; http://n2t.net/addgene:125778 ; RRID:Addgene_125778)
  • For your References section:

    WRN helicase is a synthetic lethal target in microsatellite unstable cancers. Chan EM, Shibue T, McFarland JM, Gaeta B, Ghandi M, Dumont N, Gonzalez A, McPartlan JS, Li T, Zhang Y, Bin Liu J, Lazaro JB, Gu P, Piett CG, Apffel A, Ali SO, Deasy R, Keskula P, Ng RWS, Roberts EA, Reznichenko E, Leung L, Alimova M, Schenone M, Islam M, Maruvka YE, Liu Y, Roper J, Raghavan S, Giannakis M, Tseng YY, Nagel ZD, D'Andrea A, Root DE, Boehm JS, Getz G, Chang S, Golub TR, Tsherniak A, Vazquez F, Bass AJ. Nature. 2019 Apr 10. pii: 10.1038/s41586-019-1102-x. doi: 10.1038/s41586-019-1102-x. 10.1038/s41586-019-1102-x PubMed 30971823