Skip to main content

pH3U3-mcs
(Plasmid #12609)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 12609 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pH3U3
  • Backbone size w/o insert (bp) 5790
  • Vector type
    Bacterial Expression
  • Selectable markers
    URA3, HIS3

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Multiple cloning site in His3 Ura3 reporter plasmid
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    44
  • GenBank ID
    DQ515893

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NotI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CAAATATGTATCCGCTCATGAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the cloning information for this plasmid has been corrected as of 1/14/09. The 5' cloning site was changed from MluI to NotI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pH3U3-mcs was a gift from Scot Wolfe (Addgene plasmid # 12609 ; http://n2t.net/addgene:12609 ; RRID:Addgene_12609)
  • For your References section:

    A bacterial one-hybrid system for determining the DNA-binding specificity of transcription factors. Meng X, Brodsky MH, Wolfe SA. Nat Biotechnol. 2005 Aug . 23(8):988-94. 10.1038/nbt1120 PubMed 16041365