Skip to main content

pSG020
(Plasmid #126503)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126503 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pJN105
  • Backbone size w/o insert (bp) 6055
  • Total vector size (bp) 8881
  • Vector type
    Bacterial Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Growth instructions
    different temperatures possible; alternative E. coli K-12 derivatives can be used as hosts; used for protein production in original host Pseudomonas aeruginosa SG17M
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    disaggregase ClpGgi with 6xHis-tag
  • Alt name
    ClpK
  • Species
    Pseudomonas aeruginosa SG17M
  • Insert Size (bp)
    2886
  • GenBank ID
    taxi:1443105 (genome) EWH27925.1 (protein)
  • Promoter PBAD
  • Tag / Fusion Protein
    • C-terminal 6xHis (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CCATAGCATTTTTATCCATAAG
  • 3′ sequencing primer AAACGACGGCCAGTGAGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSG020 was a gift from Ute Romling (Addgene plasmid # 126503 ; http://n2t.net/addgene:126503 ; RRID:Addgene_126503)
  • For your References section:

    Stand-alone ClpG disaggregase confers superior heat tolerance to bacteria. Lee C, Franke KB, Kamal SM, Kim H, Lunsdorf H, Jager J, Nimtz M, Trcek J, Jansch L, Bukau B, Mogk A, Romling U. Proc Natl Acad Sci U S A. 2018 Jan 9;115(2):E273-E282. doi: 10.1073/pnas.1712051115. Epub 2017 Dec 20. 10.1073/pnas.1712051115 PubMed 29263094