pSG020
(Plasmid
#126503)
-
PurposePseudomonas aeruginosa disaggregase ClpG(GI) cloned as ClpG(GI)-6xHis
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 126503 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepJN105
- Backbone size w/o insert (bp) 6055
- Total vector size (bp) 8881
-
Vector typeBacterial Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Streptomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Growth instructionsdifferent temperatures possible; alternative E. coli K-12 derivatives can be used as hosts; used for protein production in original host Pseudomonas aeruginosa SG17M
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedisaggregase ClpGgi with 6xHis-tag
-
Alt nameClpK
-
SpeciesPseudomonas aeruginosa SG17M
-
Insert Size (bp)2886
-
GenBank IDtaxi:1443105 (genome) EWH27925.1 (protein)
- Promoter PBAD
-
Tag
/ Fusion Protein
- C-terminal 6xHis (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CCATAGCATTTTTATCCATAAG
- 3′ sequencing primer AAACGACGGCCAGTGAGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG020 was a gift from Ute Romling (Addgene plasmid # 126503 ; http://n2t.net/addgene:126503 ; RRID:Addgene_126503) -
For your References section:
Stand-alone ClpG disaggregase confers superior heat tolerance to bacteria. Lee C, Franke KB, Kamal SM, Kim H, Lunsdorf H, Jager J, Nimtz M, Trcek J, Jansch L, Bukau B, Mogk A, Romling U. Proc Natl Acad Sci U S A. 2018 Jan 9;115(2):E273-E282. doi: 10.1073/pnas.1712051115. Epub 2017 Dec 20. 10.1073/pnas.1712051115 PubMed 29263094