Skip to main content

pHAGE-EF1aL-nlsGFP-W
(Plasmid #126688)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 126688 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pHAGE
  • Backbone manufacturer
    Derived in Kotton lab
  • Backbone size w/o insert (bp) 6978
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nlsGFP
  • Species
    A. Victoria (Jellyfish), Human promoter
  • Insert Size (bp)
    763
  • Promoter EF1aL
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • 6xHIS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ccattatcgtttcagacccacctcc
  • 3′ sequencing primer TCGCCCTCGAACTTCACCTCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHAGE-EF1aL-nlsGFP-W was a gift from Darrell Kotton (Addgene plasmid # 126688 ; http://n2t.net/addgene:126688 ; RRID:Addgene_126688)
  • For your References section:

    Collective curvature sensing and fluidity in three-dimensional multicellular systems. Tang W, Das A, Pegoraro AF, Han YL, Huang J, Roberts DA, Yang H, Fredberg JJ, Kotton DN, Bi D, Guo M. Nat. Phys. 18, 1371–1378 (2022). 10.1038/s41567-022-01747-0