pHAGE-EF1aL-nlsGFP-W
(Plasmid
#126688)
-
PurposeConstitutive, ubiquitous, nuclear-localized GFP expression.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 126688 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepHAGE
-
Backbone manufacturerDerived in Kotton lab
- Backbone size w/o insert (bp) 6978
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namenlsGFP
-
SpeciesA. Victoria (Jellyfish), Human promoter
-
Insert Size (bp)763
- Promoter EF1aL
-
Tags
/ Fusion Proteins
- NLS (N terminal on insert)
- 6xHIS (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer ccattatcgtttcagacccacctcc
- 3′ sequencing primer TCGCCCTCGAACTTCACCTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byBalazs Laboratory
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHAGE-EF1aL-nlsGFP-W was a gift from Darrell Kotton (Addgene plasmid # 126688 ; http://n2t.net/addgene:126688 ; RRID:Addgene_126688) -
For your References section:
Collective curvature sensing and fluidity in three-dimensional multicellular systems. Tang W, Das A, Pegoraro AF, Han YL, Huang J, Roberts DA, Yang H, Fredberg JJ, Kotton DN, Bi D, Guo M. Nat. Phys. 18, 1371–1378 (2022). 10.1038/s41567-022-01747-0