LentiGuide-BC-CMV-Puro
              
              
                (Plasmid
                
                #127169)
              
            
            
            
          - 
            PurposePCR template for CMV-puro resistance cassette
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127169 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLenti (Addgene #61427)
- 
              Vector typeMammalian Expression, Lentiviral, CRISPR
- 
                Selectable markersPuromycin
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)NEB Stable
- 
            Copy numberHigh Copy
Gene/Insert
- 
                Gene/Insert nameNone
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer CCACATAGCGTAAAAGGAGC (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Cloning Method: Golden Gate; Cloning Site 3-prime: CCACATAGCGTAAAAGGAGC
Please visit https://www.biorxiv.org/content/10.1101/383943v1 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: LentiGuide-BC-CMV-Puro was a gift from Paul Blainey (Addgene plasmid # 127169 ; http://n2t.net/addgene:127169 ; RRID:Addgene_127169)
- 
                For your References section: Optical Pooled Screens in Human Cells. Feldman D, Singh A, Schmid-Burgk JL, Carlson RJ, Mezger A, Garrity AJ, Zhang F, Blainey PC. Cell. 2019 Oct 17;179(3):787-799.e17. doi: 10.1016/j.cell.2019.09.016. 10.1016/j.cell.2019.09.016 PubMed 31626775
