-
PurposeBeYDV replicon with constitutive Luc expression, IPT, sgRNA targeting PDS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127215 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTRANS_201
-
Backbone manufacturerCambia
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuc, IPT, sgRNA
-
gRNA/shRNA sequenceTTGGTAGTAGCGACTCCATG
-
SpeciesFirefly, A. tumefaciens, synthetic
-
Mutationcodon optimized CDSs
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
- 3′ cloning site unknown (unknown if destroyed)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMM134 was a gift from Daniel Voytas (Addgene plasmid # 127215 ; http://n2t.net/addgene:127215 ; RRID:Addgene_127215) -
For your References section:
Plant gene editing through de novo induction of meristems. Maher MF, Nasti RA, Vollbrecht M, Starker CG, Clark MD, Voytas DF. Nat Biotechnol. 2019 Dec 16. pii: 10.1038/s41587-019-0337-2. doi: 10.1038/s41587-019-0337-2. 10.1038/s41587-019-0337-2 PubMed 31844292