-
PurposeDouble mutant of wild type mmPylRS designed for incorporation of non-canonical amino acids with mono-substituted phenylalanine derivatives and tyrosinyl ethers
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127411 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepEVOL
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePyrrolysyl-tRNA synthetase/pyrrolysyl -tRNA pair
-
Alt namePylRS/Pyl-tRNA
-
SpeciesMethanosarcina mazei
-
MutationN346A-C348A
- Promoter araBAD
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCCGTTTTTT
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEVOL-pylT-N346A/C348A was a gift from Wenshe Liu (Addgene plasmid # 127411 ; http://n2t.net/addgene:127411 ; RRID:Addgene_127411) -
For your References section:
A rationally designed pyrrolysyl-tRNA synthetase mutant with a broad substrate spectrum. Wang YS, Fang X, Wallace AL, Wu B, Liu WR. J Am Chem Soc. 2012 Feb 15;134(6):2950-3. doi: 10.1021/ja211972x. Epub 2012 Feb 6. 10.1021/ja211972x PubMed 22289053