pES134
(Plasmid
#127551)
-
PurposeVariant of pKD13. Lambda Red recombineering PCR template plasmid carrying an F3-aadA-F3 cassette orthogonal to FRT-KanR-FRT in pKD13
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepKD13
-
Backbone manufacturerKEIO collection material
- Backbone size w/o insert (bp) 2000
- Total vector size (bp) 3099
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Growth instructionsThe insert is stable and the plasmid can be selected on sole ampicillin
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameF3-flanked spectinomycin resistance cassette
-
Alt nameF3-J23116-B0034m-aadA-F3
-
SpeciesSynthetic
-
Insert Size (bp)1000
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer cctcgctttgtaacggagtagag
- 3′ sequencing primer gacggatggcctttttgcgtggc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2024.01.17.576040 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pES134 was a gift from Emmanuele Severi & Gavin Thomas (Addgene plasmid # 127551 ; http://n2t.net/addgene:127551 ; RRID:Addgene_127551) -
For your References section:
Characterisation of anhydro-sialic acid transporters from mucosa-associated bacteria. Wu Y, Bell A, Thomas GH, Bolam DN, Sargent F, Juge N, Palmer T, Severi E. Microbiology (Reading). 2024 Mar;170(3). doi: 10.1099/mic.0.001448. 10.1099/mic.0.001448 PubMed 38488830