pES134
(Plasmid #127551)

• Purpose: Variant of pKD13. Lambda Red recombineering PCR template plasmid carrying an F3-aadA-F3 cassette orthogonal to FRT-KanR-FRT in pKD13
• Depositing Labs: Emmanuele Severi, Gavin Thomas
• Publication: Wu et al Microbiology (Reading). 2024 Mar;170(3). doi: 10.1099/mic.0.001448.

Backbone

• Vector backbone: pKD13
• Backbone manufacturer: KEIO collection material
• Backbone size w/o insert (bp): 2000
• Total vector size (bp): 3099
• Vector type: Bacterial Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Growth instructions: The insert is stable and the plasmid can be selected on sole ampicillin
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: F3-flanked spectinomycin resistance cassette
• Alt name: F3-J23116-B0034m-aadA-F3
• Species: Synthetic
• Insert Size (bp): 1000

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: cctcgctttgtaacggagtagag
• 3′ sequencing primer: gacggatggcctttttgcgtggc

Resource Information

• Supplemental Documents:
  • pes134-pkd13f3-aada-f3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://doi.org/10.1101/2024.01.17.576040 for bioRxiv preprint.