Skip to main content

pCFD3-frame_selector_1
(Plasmid #127554)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127554 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCFD3
  • Backbone manufacturer
    Fillip Port and Simon Bullock
  • Vector type
    Insect Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA frame 1
  • gRNA/shRNA sequence
    GGCCAGTACCCAAAAAGCGG
  • Promoter dU6:3

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (unknown if destroyed)
  • 3′ cloning site BbsI (unknown if destroyed)
  • 5′ sequencing primer acctactcagccaagaggc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCFD3-frame_selector_1 was a gift from Norbert Perrimon (Addgene plasmid # 127554 ; http://n2t.net/addgene:127554 ; RRID:Addgene_127554)
  • For your References section:

    Gene Knock-Ins in Drosophila Using Homology-Independent Insertion of Universal Donor Plasmids. Bosch JA, Colbeth R, Zirin J, Perrimon N. Genetics. 2019 Nov 4. pii: genetics.119.302819. doi: 10.1534/genetics.119.302819. 10.1534/genetics.119.302819 PubMed 31685521