LADL Bridge + Promoter Only Target
(Plasmid
#127669)
-
PurposeEncodes for CRY2-HA and mCherry proteins expressed from the EF1a promoter as well as 2 gRNAs targeting the Zfp462 promoter expressed from their individual hU6 promoters
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127669 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneDerived from pUC19
-
Backbone manufacturerCremins lab
- Backbone size w/o insert (bp) 4437
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCRY2-HA-2A-mCherry and gRNAs 115 and 117
-
gRNA/shRNA sequenceTAAAGAAAAGTGTTTATCGA, AAGTGTTTATCGAGGGAAAG
-
SpeciesSynthetic
-
Insert Size (bp)4194
- Promoter EF1a and hU6
-
Tag
/ Fusion Protein
- HA (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer EF-1a Forward
- 3′ sequencing primer BGH Reverse
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LADL Bridge + Promoter Only Target was a gift from Jennifer Phillips-Cremins (Addgene plasmid # 127669 ; http://n2t.net/addgene:127669 ; RRID:Addgene_127669) -
For your References section:
LADL: light-activated dynamic looping for endogenous gene expression control. Kim JH, Rege M, Valeri J, Dunagin MC, Metzger A, Titus KR, Gilgenast TG, Gong W, Beagan JA, Raj A, Phillips-Cremins JE. Nat Methods. 2019 Jun 24. pii: 10.1038/s41592-019-0436-5. doi: 10.1038/s41592-019-0436-5. 10.1038/s41592-019-0436-5 PubMed 31235883