Skip to main content

LADL Bridge + Promoter Only Target
(Plasmid #127669)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127669 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Derived from pUC19
  • Backbone manufacturer
    Cremins lab
  • Backbone size w/o insert (bp) 4437
  • Vector type
    Mammalian Expression, CRISPR
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    CRY2-HA-2A-mCherry and gRNAs 115 and 117
  • gRNA/shRNA sequence
    TAAAGAAAAGTGTTTATCGA, AAGTGTTTATCGAGGGAAAG
  • Species
    Synthetic
  • Insert Size (bp)
    4194
  • Promoter EF1a and hU6
  • Tag / Fusion Protein
    • HA (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer EF-1a Forward
  • 3′ sequencing primer BGH Reverse
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LADL Bridge + Promoter Only Target was a gift from Jennifer Phillips-Cremins (Addgene plasmid # 127669 ; http://n2t.net/addgene:127669 ; RRID:Addgene_127669)
  • For your References section:

    LADL: light-activated dynamic looping for endogenous gene expression control. Kim JH, Rege M, Valeri J, Dunagin MC, Metzger A, Titus KR, Gilgenast TG, Gong W, Beagan JA, Raj A, Phillips-Cremins JE. Nat Methods. 2019 Jun 24. pii: 10.1038/s41592-019-0436-5. doi: 10.1038/s41592-019-0436-5. 10.1038/s41592-019-0436-5 PubMed 31235883