Skip to main content
Addgene

pSpCas9(BB)-2A-Neo
(Plasmid #127762)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 127762 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pSpCas9(BB)-2A-Puro (PX459) V2.0 (Addgene#62988)
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Empty backbone

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer AGCTGGGAGGCGACAAAAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pSpCas9(BB)-2A-Puro (PX459) V2.0 was digested with EcoRI to remove the T2A-Puro cassette, and a P2A-Neomycin cassette was amplified by PCR, digested with EcoRI, and ligated.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSpCas9(BB)-2A-Neo was a gift from Ken-Ichi Takemaru (Addgene plasmid # 127762 ; http://n2t.net/addgene:127762 ; RRID:Addgene_127762)