-
PurposeSleeping Beauty Transposase expression vector driven by the CAG promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 127909 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSleeping Beauty Transposase
-
Alt nameSB100X
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGGTTATTGTCTCATGAGCGG
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
SB100X in pCAG globin pA was a gift from Mark Groudine (Addgene plasmid # 127909 ; http://n2t.net/addgene:127909 ; RRID:Addgene_127909) -
For your References section:
HP1alpha is a chromatin crosslinker that controls nuclear and mitotic chromosome mechanics. Strom AR, Biggs RJ, Banigan EJ, Wang X, Chiu K, Herman C, Collado J, Yue F, Ritland Politz JC, Tait LJ, Scalzo D, Telling A, Groudine M, Brangwynne CP, Marko JF, Stephens AD. Elife. 2021 Jun 9;10. pii: 63972. doi: 10.7554/eLife.63972. 10.7554/eLife.63972 PubMed 34106828