-
Purpose(Empty Backbone) To express a protein of interest fused to the C-terminus of mNeonGreen
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 128144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+
-
Vector typeMammalian Expression
-
Tag
/ Fusion Protein
- mNeonGreen fusion (N terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GCGTGCCTAATGGGAGGTCT (CSF)
- 3′ sequencing primer CACTGCATTCTAGTTCTGGT (CSR)
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCS2+mNeonGreen-C Cloning Vector was a gift from Ken-Ichi Takemaru (Addgene plasmid # 128144 ; http://n2t.net/addgene:128144 ; RRID:Addgene_128144)