Skip to main content

pB1H2 UV5 Zif268-cons (2-hybrid bait plasmid)
(Plasmid #128164)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128164 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pB1H2w2-zif268 (ColE1)
  • Backbone size w/o insert (bp) 3695
  • Total vector size (bp) 3747
  • Modifications to backbone
    Omega subunit of RNA polymerase removed from original vector. 10 amino acid glycine/serine linker followed by ERBIN PDZ consensus ligand sequence (WETWV) fused to c-terminus of zif268. UV2 promoter changed to UV5.
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    10 amino acid glycine/serine linker + ERBIN PDZ consensus ligand (WETWV)
  • Species
    Synthetic
  • Insert Size (bp)
    52
  • Promoter UV5
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • zif268 (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGCCAGGATCTTCAGCGGAG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pB1H2 UV5 Zif268-cons (2-hybrid bait plasmid) was a gift from Marcus Noyes (Addgene plasmid # 128164 ; http://n2t.net/addgene:128164 ; RRID:Addgene_128164)
  • For your References section:

    A Multireporter Bacterial 2-Hybrid Assay for the High-Throughput and Dynamic Assay of PDZ Domain-Peptide Interactions. Ichikawa DM, Corbi-Verge C, Shen MJ, Snider J, Wong V, Stagljar I, Kim PM, Noyes MB. ACS Synth Biol. 2019 May 17;8(5):918-928. doi: 10.1021/acssynbio.8b00499. Epub 2019 Apr 18. 10.1021/acssynbio.8b00499 PubMed 30969105