pB1H2 UV5 Zif268-5ala (2-hybrid bait plasmid)
(Plasmid
#128165)
-
PurposeUV5 promoter drives expression of Zif268-5alanine peptide fusion. Pair with pGHUC w-ERBIN as a negative control (doesn't turn on HIS3/GFP).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 128165 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepB1H2w2-zif268 (ColE1)
- Backbone size w/o insert (bp) 3695
- Total vector size (bp) 3747
-
Modifications to backboneOmega subunit of RNA polymerase removed from original vector. 10 amino acid glycine/serine linker followed by 5 alanines fused to c-terminus of zif268. UV2 promoter changed to UV5.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name10 amino acid glycine/serine linker + 5alanines
-
SpeciesSynthetic
-
Insert Size (bp)52
- Promoter UV5
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- zif268 (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGCCAGGATCTTCAGCGGAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB1H2 UV5 Zif268-5ala (2-hybrid bait plasmid) was a gift from Marcus Noyes (Addgene plasmid # 128165 ; http://n2t.net/addgene:128165 ; RRID:Addgene_128165) -
For your References section:
A Multireporter Bacterial 2-Hybrid Assay for the High-Throughput and Dynamic Assay of PDZ Domain-Peptide Interactions. Ichikawa DM, Corbi-Verge C, Shen MJ, Snider J, Wong V, Stagljar I, Kim PM, Noyes MB. ACS Synth Biol. 2019 May 17;8(5):918-928. doi: 10.1021/acssynbio.8b00499. Epub 2019 Apr 18. 10.1021/acssynbio.8b00499 PubMed 30969105