Skip to main content

pRSET-iSeroSnFR
(Plasmid #128483)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 128483 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pRSET-A
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 2870
  • Total vector size (bp) 4452
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iSeroSnFR
  • Insert Size (bp)
    1570
  • Promoter T7
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • T7 (N terminal on insert)
    • cpsfGFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer T7 - taatacgactcactataggg
  • 3′ sequencing primer T7-term - gctagttattgctcagcgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRSET-iSeroSnFR was a gift from Lin Tian (Addgene plasmid # 128483 ; http://n2t.net/addgene:128483 ; RRID:Addgene_128483)
  • For your References section:

    Directed Evolution of a Selective and Sensitive Serotonin Sensor via Machine Learning. Unger EK, Keller JP, Altermatt M, Liang R, Matsui A, Dong C, Hon OJ, Yao Z, Sun J, Banala S, Flanigan ME, Jaffe DA, Hartanto S, Carlen J, Mizuno GO, Borden PM, Shivange AV, Cameron LP, Sinning S, Underhill SM, Olson DE, Amara SG, Temple Lang D, Rudnick G, Marvin JS, Lavis LD, Lester HA, Alvarez VA, Fisher AJ, Prescher JA, Kash TL, Yarov-Yarovoy V, Gradinaru V, Looger LL, Tian L. Cell. 2020 Dec 12. pii: S0092-8674(20)31612-3. doi: 10.1016/j.cell.2020.11.040. 10.1016/j.cell.2020.11.040 PubMed 33333022