Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pDisplay-iSeroSnFR
(Plasmid #128484)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 128484 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMinDisplay
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 4990
  • Total vector size (bp) 6880
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    iSeroSnFR
  • Insert Size (bp)
    1900
  • Promoter CMV
  • Tags / Fusion Proteins
    • cpsfGFP
    • Ig-kappa leader (N terminal on insert)
    • Myc (C terminal on insert)
    • PDGFR + enhanced ER export (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer T7 - taatacgactcactataggg
  • 3′ sequencing primer BGH-rev - TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDisplay-iSeroSnFR was a gift from Lin Tian (Addgene plasmid # 128484 ; http://n2t.net/addgene:128484 ; RRID:Addgene_128484)
  • For your References section:

    Directed Evolution of a Selective and Sensitive Serotonin Sensor via Machine Learning. Unger EK, Keller JP, Altermatt M, Liang R, Matsui A, Dong C, Hon OJ, Yao Z, Sun J, Banala S, Flanigan ME, Jaffe DA, Hartanto S, Carlen J, Mizuno GO, Borden PM, Shivange AV, Cameron LP, Sinning S, Underhill SM, Olson DE, Amara SG, Temple Lang D, Rudnick G, Marvin JS, Lavis LD, Lester HA, Alvarez VA, Fisher AJ, Prescher JA, Kash TL, Yarov-Yarovoy V, Gradinaru V, Looger LL, Tian L. Cell. 2020 Dec 12. pii: S0092-8674(20)31612-3. doi: 10.1016/j.cell.2020.11.040. 10.1016/j.cell.2020.11.040 PubMed 33333022