pAAV-CAG-iSeroSnFR-Nlgn
(Plasmid #128485)

• Purpose: Fluorescent reporter for serotonin (dendrite localization tag)
• Depositing Lab: Lin Tian
• Publication: Unger et al Cell. 2020 Dec 12. pii: S0092-8674(20)31612-3. doi: 10.1016/j.cell.2020.11.040.

Backbone

• Vector backbone: pAAV
  (Search Vector Database)
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 7410
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: iSeroSnFR
• Insert Size (bp): 2410
• Promoter: CAG
• Tags / Fusion Proteins:
  • Ig-kappa leader (N terminal on insert)
  • Full-length neuroligin (C terminal on insert)
  • cpsfGFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: pCAG-N - cctccttgtataaatcctgg
• 3′ sequencing primer: pCAG-C - ccaggatttatacaaggagg

Resource Information

• Supplemental Documents:
  • pAAV-CAG-iSeroSnFR-Nlgn.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Ancillary Agreement for Plasmids Containing FP Materials
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC NGS analysis was unable to verify both AAV ITR sequences. It is unknown if this may impact plasmid function.