pAAV-CAG-iSeroSnFR-Nlgn
(Plasmid #128485)

• Purpose: Fluorescent reporter for serotonin (dendrite localization tag)
• Depositing Lab: Lin Tian
• Publication: Unger et al Cell. 2020 Dec 12. pii: S0092-8674(20)31612-3. doi: 10.1016/j.cell.2020.11.040.

Backbone

• Vector backbone: pAAV
• Backbone size w/o insert (bp): 5000
• Total vector size (bp): 7410
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: iSeroSnFR
• Insert Size (bp): 2410
• Promoter: CAG
• Tags / Fusion Proteins:
  • Ig-kappa leader (N terminal on insert)
  • Full-length neuroligin (C terminal on insert)
  • cpsfGFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: HindIII (not destroyed)
• 5′ sequencing primer: pCAG-N - cctccttgtataaatcctgg
• 3′ sequencing primer: pCAG-C - ccaggatttatacaaggagg

Resource Information

• Supplemental Documents:
  • pAAV-CAG-iSeroSnFR-Nlgn.gbk
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Addgene QC NGS analysis was unable to verify both AAV ITR sequences. It is unknown if this may impact plasmid function.

Information for AAV9 (Catalog # 128485-AAV9)

Purpose

Ready-to-use AAV9 particles produced from pAAV-CAG-iSeroSnFR-Nlgn (#128485). In addition to the viral particles, you will also receive purified pAAV-CAG-iSeroSnFR-Nlgn plasmid DNA.

CAG-driven expression of a fluorescent reporter for serotonin (localized to dendrites). These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 1×10¹³ vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
• Buffer: PBS + 0.001% Pluronic F-68
• Serotype: AAV9
• Purification: Iodixanol gradient ultracentrifugation

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Ancillary Agreement for Penn Vectors
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.