Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSL1103
(Plasmid #129526)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 129526 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEF
  • Vector type
    Plasmodium, rodent-infectious species
  • Selectable markers
    Pyrimethamine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dSpCas9
  • gRNA/shRNA sequence
    GGCGAGGGCCGCCCCTACGA
  • Species
    S. pyogenes
  • Insert Size (bp)
    4269
  • Tag / Fusion Protein
    • NLS, 1xHA

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Gene origin for dSpCas9 is from Addgene #48240

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSL1103 was a gift from Scott Lindner (Addgene plasmid # 129526 ; http://n2t.net/addgene:129526 ; RRID:Addgene_129526)
  • For your References section:

    Ribozyme-mediated, multiplex CRISPR gene editing and CRISPR interference (CRISPRi) in rodent-infectious Plasmodium yoelii. Walker MP, Lindner SE. J Biol Chem. 2019 Jun 14;294(24):9555-9566. doi: 10.1074/jbc.RA118.007121. Epub 2019 May 1. 10.1074/jbc.RA118.007121 PubMed 31043479