Skip to main content

pSL1103
(Plasmid #129526)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 129526 Standard format: Plasmid sent in bacteria as agar stab 1 $94
DNA 129526-D50 50 μg of DNA in Tris buffer $495
DNA 129526-D100 100 μg of DNA in Tris buffer $585

Backbone

  • Vector backbone
    pDEF
  • Vector type
    Plasmodium, rodent-infectious species
  • Selectable markers
    Pyrimethamine

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    dSpCas9
  • gRNA/shRNA sequence
    GGCGAGGGCCGCCCCTACGA
  • Species
    S. pyogenes
  • Insert Size (bp)
    4269
  • Tag / Fusion Protein
    • NLS, 1xHA

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Gene origin for dSpCas9 is from Addgene #48240

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSL1103 was a gift from Scott Lindner (Addgene plasmid # 129526 ; http://n2t.net/addgene:129526 ; RRID:Addgene_129526)
  • For your References section:

    Ribozyme-mediated, multiplex CRISPR gene editing and CRISPR interference (CRISPRi) in rodent-infectious Plasmodium yoelii. Walker MP, Lindner SE. J Biol Chem. 2019 Jun 14;294(24):9555-9566. doi: 10.1074/jbc.RA118.007121. Epub 2019 May 1. 10.1074/jbc.RA118.007121 PubMed 31043479