pUC57-PB-PGK-tetR-3xFLAG-HA-2A-Puro
(Plasmid
#129537)
-
PurposePiggyBac transposon carrying tetR-3xFLAG-HA-2A-Puro under the PGK promoter.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 129537 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepUC57_PB-PGK-tetR-KRAB-2A-Puro
- Backbone size w/o insert (bp) 5177
- Total vector size (bp) 5518
-
Vector typeSynthetic Biology
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametetR-3xFlag-HA-2A-Puro
-
SpeciesSynthetic
-
Insert Size (bp)1539
- Promoter hPGK promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MfeI (not destroyed)
- 3′ cloning site BstbI (not destroyed)
- 5′ sequencing primer TCGAGGATCAGGAACATCAA
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC57-PB-PGK-tetR-3xFLAG-HA-2A-Puro was a gift from Hideyuki Okano (Addgene plasmid # 129537 ; http://n2t.net/addgene:129537 ; RRID:Addgene_129537) -
For your References section:
Controlling gene activation by enhancers through a drug-inducible topological insulator. Tsujimura T, Takase O, Yoshikawa M, Sano E, Hayashi M, Hoshi K, Takato T, Toyoda A, Okano H, Hishikawa K. Elife. 2020 May 5;9. pii: 47980. doi: 10.7554/eLife.47980. 10.7554/eLife.47980 PubMed 32369019