pGPΩTp
(Plasmid
#130660)
-
PurposeInsertional mutagenesis of GP transposon into chromosome of B. cenocepacia. Trimethoprim selection for plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGP704
-
Backbone manufacturerJohn Mekalanos
- Backbone size w/o insert (bp) 3705
- Total vector size (bp) 3942
-
Modifications to backboneAddition of trimethoprim cassette and Ω sites flanking it.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Trimethoprim, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Pir1
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameΩ trimethoprim cassette
-
SpeciespMLBAD
-
Insert Size (bp)237
-
MutationAddition of Ω sites next to trimethoprim cassette in pHP45ΩTp
- Promoter dhfr promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site ScaI (not destroyed)
- 5′ sequencing primer cgacggatcccaagcttcttctaga
- 3′ sequencing primer TAACGGTTGTGGACAACAAGCCAGGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bydhfr cloned from pMLBAD, constructed by John Mekalanos.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: We do not have the exact sequence. Size of plasmid is approximated.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGPΩTp was a gift from Miguel Valvano (Addgene plasmid # 130660 ; http://n2t.net/addgene:130660 ; RRID:Addgene_130660) -
For your References section:
Burkholderia cenocepacia requires a periplasmic HtrA protease for growth under thermal and osmotic stress and for survival in vivo. Flannagan RS, Aubert D, Kooi C, Sokol PA, Valvano MA. Infect Immun. 2007 Apr;75(4):1679-89. Epub 2007 Jan 12. 10.1128/IAI.01581-06 PubMed 17220310