pGPΩTp
(Plasmid #130660)

• Purpose: Insertional mutagenesis of GP transposon into chromosome of B. cenocepacia. Trimethoprim selection for plasmid.
• Depositing Lab: Miguel Valvano
• Publication: Flannagan et al Infect Immun. 2007 Apr;75(4):1679-89. Epub 2007 Jan 12.

Backbone

• Vector backbone: pGP704
• Backbone manufacturer: John Mekalanos
• Backbone size w/o insert (bp): 3705
• Total vector size (bp): 3942
• Modifications to backbone: Addition of trimethoprim cassette and Ω sites flanking it.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Trimethoprim
• Growth Temperature: 37°C
• Growth Strain(s): Pir1
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: Ω trimethoprim cassette
• Species: pMLBAD
• Insert Size (bp): 237
• Mutation: Addition of Ω sites next to trimethoprim cassette in pHP45ΩTp
• Promoter: dhfr promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: ScaI (not destroyed)
• 5′ sequencing primer: cgacggatcccaagcttcttctaga
• 3′ sequencing primer: TAACGGTTGTGGACAACAAGCCAGGG

Resource Information

• A portion of this plasmid was derived from a plasmid made by: dhfr cloned from pMLBAD, constructed by John Mekalanos.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Note: We do not have the exact sequence. Size of plasmid is approximated.