Pub-mCD8:GFP-T2A-DsRed:NLS-SV40
(Plasmid
#130665)
-
PurposePlasmid to test the efficiency of T2A multiplexing in Aedes aegypti
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130665 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepMos-3xP3-dsRed
- Backbone size w/o insert (bp) 8200
- Total vector size (bp) 11980
-
Modifications to backboneremoved 3xP3-dsRed marker by PCR
-
Vector typeInsect Expression ; Ae. aegypti expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAaegPUb-mCD8-GFP-T2A-dsRed-NLS-SV40
-
SpeciesM. musculus (mouse), Synthetic; Aedes aegypti
-
Insert Size (bp)3780
- Promoter Aedes aegypti poly-ubiquitin
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CAGGAAACAGCTATGACC
- 3′ sequencing primer GCAATAGCATCACAAATTTCA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pub-mCD8:GFP-T2A-DsRed:NLS-SV40 was a gift from Leslie Vosshall (Addgene plasmid # 130665 ; http://n2t.net/addgene:130665 ; RRID:Addgene_130665) -
For your References section:
The ion channel ppk301 controls freshwater egg-laying in the mosquito Aedes aegypti. Matthews BJ, Younger MA, Vosshall LB. eLife. 2019 May 21;8. pii: 43963. doi: 10.7554/eLife.43963. 10.7554/eLife.43963 PubMed 31112133