Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

(Plasmid #130665)


Item Catalog # Description Quantity Price (USD)
Plasmid 130665 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 8200
  • Total vector size (bp) 11980
  • Modifications to backbone
    removed 3xP3-dsRed marker by PCR
  • Vector type
    Insect Expression ; Ae. aegypti expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
  • Copy number


  • Gene/Insert name
  • Species
    M. musculus (mouse), Synthetic; Aedes aegypti
  • Insert Size (bp)
  • Promoter Aedes aegypti poly-ubiquitin

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CAGGAAACAGCTATGACC
  • 3′ sequencing primer GCAATAGCATCACAAATTTCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Pub-mCD8:GFP-T2A-DsRed:NLS-SV40 was a gift from Leslie Vosshall (Addgene plasmid # 130665 ; ; RRID:Addgene_130665)
  • For your References section:

    The ion channel ppk301 controls freshwater egg-laying in the mosquito Aedes aegypti. Matthews BJ, Younger MA, Vosshall LB. Elife. 2019 May 21;8. pii: 43963. doi: 10.7554/eLife.43963. 10.7554/eLife.43963 PubMed 31112133