-
PurposeExpresses FRB-NFAST in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130812 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepIRES
- Backbone size w/o insert (bp) 3960
- Total vector size (bp) 4647
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameFRB-NFAST
-
Alt nameFRB fused to the N-terminal part of splitFAST
-
SpeciesSynthetic
-
Insert Size (bp)697
- Promoter CMV
-
Tag
/ Fusion Protein
- myc-tag (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAG148 FRB-NFAST was a gift from Arnaud Gautier (Addgene plasmid # 130812 ; http://n2t.net/addgene:130812 ; RRID:Addgene_130812) -
For your References section:
A split fluorescent reporter with rapid and reversible complementation. Tebo AG, Gautier A. Nat Commun. 2019 Jun 27;10(1):2822. doi: 10.1038/s41467-019-10855-0. 10.1038/s41467-019-10855-0 PubMed 31249300