mDlx-SynTagMA_post-2A-mCerulean
(Plasmid
#130899)
-
PurposeSynaptic Tag for Mapping Activity in GABAergic neurons
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130899 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 3868
- Total vector size (bp) 7633
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSynTagMA
-
SpeciesSynthetic
- Promoter mDlx
-
Tag
/ Fusion Protein
- mCerulean (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site blunt (unknown if destroyed)
- 3′ cloning site AscI (not destroyed)
- 5′ sequencing primer TATACACTCACAGTGGTTTGGC
- 3′ sequencing primer TTACTTGTACAGCTCGTCCATG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mDlx-SynTagMA_post-2A-mCerulean was a gift from Simon Wiegert (Addgene plasmid # 130899 ; http://n2t.net/addgene:130899 ; RRID:Addgene_130899) -
For your References section:
Freeze-frame imaging of synaptic activity using SynTagMA. Perez-Alvarez A, Fearey BC, O'Toole RJ, Yang W, Arganda-Carreras I, Lamothe-Molina PJ, Moeyaert B, Mohr MA, Panzera LC, Schulze C, Schreiter ER, Wiegert JS, Gee CE, Hoppa MB, Oertner TG. Nat Commun. 2020 May 18;11(1):2464. doi: 10.1038/s41467-020-16315-4. 10.1038/s41467-020-16315-4 PubMed 32424147