Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pLY53
(Plasmid #130911)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 130911 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB4A3mut
  • Backbone manufacturer
    Original version designed by: Reshma Shetty; Mutations introduced by: unknown
  • Backbone size w/o insert (bp) 3337
  • Total vector size (bp) 10491
  • Vector type
    Bacterial Expression, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Culture in the Lennox’s Luria-Bertani (LB) medium (10 g/L peptone, 5 g/L yeast extract, 5 g/L NaCl)
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    dcas9
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    4170
  • Mutation
    Mutations D10A and H840A on WT cas9. Synonymous mutation at R63 of dcas9 (CGT>CGC); Synonymous mutation at R447 of dcas9 (CGA>CGT)
  • Promoter Ptet

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer TGCCACCTGACGTCTAAGAA
  • 3′ sequencing primer TGCGCTGTTAATCACTTTACTTTTATCTAATCTTG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    tetR
  • Species
    E. coli
  • Insert Size (bp)
    790
  • Mutation
    Synonymous mutation at S2 of tetR (TCT>TCA)
  • Promoter Ptet

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GAGCTGTCCGTTTGAGGCGAGTCGCTTCCGCTG
  • 3′ sequencing primer CACGAATATTTCCCGGCCAACGATAATTCAGC
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    pspFΔHTH::λN22plus
  • Species
    Synthetic; E. coli
  • Insert Size (bp)
    1084
  • Mutation
    The HTH domain of the pspF gene was deleted (297-326). Mutations D2N and Q4R in the λN22 domain.
  • Promoter Anderson promoter: J23106
  • Tag / Fusion Protein
    • pspFΔHTH::λN22plus (C terminal on insert)

Cloning Information for Gene/Insert 3

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site SpeI (destroyed during cloning)
  • 5′ sequencing primer AGCATCAAGTCGCTAAAGAAGAAAGGGAAACACCTACTACTG
  • 3′ sequencing primer CTCGCCACGCACGGAAAACTTATGACCGTTGAC
  • (Common Sequencing Primers)

Gene/Insert 4

  • Gene/Insert name
    sfgfp
  • Species
    Synthetic
  • Insert Size (bp)
    1110
  • Promoter PpspA-LEA1B1
  • Tag / Fusion Protein
    • ASV tag (C terminal on insert)

Cloning Information for Gene/Insert 4

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (destroyed during cloning)
  • 3′ cloning site SpeI, PstI (not destroyed)
  • 5′ sequencing primer CTGCAACTCAGTTTGCAAATGAATGCAC
  • 3′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

Depositor Comments

The Top10 bacterial strain should be used for downstream applications

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLY53 was a gift from Baojun Wang (Addgene plasmid # 130911 ; http://n2t.net/addgene:130911 ; RRID:Addgene_130911)
  • For your References section:

    Engineered CRISPRa enables programmable eukaryote-like gene activation in bacteria. Yang Liu, Xinyi Wan & Baojun Wang. Nature Communications 10, August 2019 10.1038/s41467-019-11479-0