-
PurposePiggyBac vector for constitutive NanoLuc expression in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 130936 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepB-EF1a-IRES-Puro
- Total vector size (bp) 8050
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNanoLuc
-
Alt nameNLuc
-
SpeciesSynthetic
-
Insert Size (bp)513
-
GenBank IDJQ437370
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BstBI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer TAGGCCAGCTTGGCACTTGATGTA
- 3′ sequencing primer CCTAGGAATGCTCGTCAAGAAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pB-EF1a-NLuc-IRES-Puro was a gift from James Thomson (Addgene plasmid # 130936 ; http://n2t.net/addgene:130936 ; RRID:Addgene_130936) -
For your References section:
An In Vitro Human Segmentation Clock Model Derived from Embryonic Stem Cells. Chu LF, Mamott D, Ni Z, Bacher R, Liu C, Swanson S, Kendziorski C, Stewart R, Thomson JA. Cell Rep. 2019 Aug 27;28(9):2247-2255.e5. doi: 10.1016/j.celrep.2019.07.090. 10.1016/j.celrep.2019.07.090 PubMed 31461642